share

D(Ggtggcgacgactcctggagcccg) CAS NO 139528-83-9


Unit Price:

CAS No.:139528-83-9

Grade:Pharmacy Grade

Content:99.9%

Brand:Customizable

Packaging:Customizable

Description

D(Ggtggcgacgactcctggagcccg) CAS NO 139528-83-9 is a synthetic oligonucleotide sequence, a critical building block for advanced molecular biology and therapeutic research. This compound is essential for applications requiring precise genetic targeting, sequence-specific binding, and high-fidelity nucleic acid interactions. It is primarily utilized by biotechnology firms, pharmaceutical R&D departments, and academic research institutions focused on gene therapy, diagnostic assay development, and antisense technology.

Application

  • Antisense Oligonucleotide (ASO) Research: Serves as a key component in the development of antisense therapies designed to modulate gene expression for treating genetic disorders.
  • PCR Primer & Probe Design: Used as a highly specific primer or hybridization probe in polymerase chain reaction (PCR) and quantitative PCR (qPCR) assays for sensitive pathogen detection or gene expression analysis.
  • Gene Editing & CRISPR Applications: Functions as a donor template or guide RNA (gRNA) scaffold component in gene editing platforms like CRISPR-Cas for precise genomic modifications.
  • Diagnostic Kit Development: Incorporated into diagnostic kits and microarrays for the detection of specific DNA/RNA sequences associated with diseases or genetic markers.
  • Nucleic Acid Aptamer Synthesis: Acts as a starting sequence in the selection and synthesis of aptamers for therapeutic targeting or biosensor applications.
  • Biochemical & Biophysical Studies: Employed in fundamental research to study DNA-protein interactions, nucleic acid structure, and folding dynamics.

Basic Information

Product Name D(Ggtggcgacgactcctggagcccg)
CAS No. 139528-83-9
Molecular Formula C228H283N87O140P23
Molecular Weight Approx. 7140.6 g/mol
Synonyms 5'-D(GGTGGCGACGACTCCTGGAGCCCG)-3'; 23-mer DNA Oligonucleotide (Sequence: GGT GGC GAC GAC TCC TGG AGC CCG); Deoxyribonucleic acid sequence; DNA oligomer; Single-stranded DNA (ssDNA); Synthetic DNA; Research Oligo; Antisense Oligo; Custom DNA Sequence
EINECS Contact for details

Quality Control

Our oligonucleotides are manufactured under GMP-like conditions and undergo rigorous analytical testing to ensure sequence integrity and purity. Each batch is characterized by HPLC for purity assessment and Mass Spectrometry (MS) for identity confirmation. Certificates of Analysis (COA) detailing purity, concentration, and analytical results are provided with every shipment to ensure traceability and compliance with your research or development protocols.

Storage

Preserve in a tightly closed container, protected from light. For long-term stability, store lyophilized powder at -20°C or below. Once reconstituted in nuclease-free buffer or water, aliquot and store at -20°C to minimize freeze-thaw cycles. This product is hygroscopic (moisture-sensitive); ensure the container is sealed tightly in a dry environment after each use.

Specification

Item Specification
Appearance White to off-white lyophilized powder
Identification (MS) Conforms to structure
Purity (HPLC) ≥ 95%
Assay (UV) ≥ 85% (by weight)
Extinction Coefficient Provided on COA
Molecular Weight Confirmed by MS
Endotoxin Level < 10 EU/mg (upon request)
Sterility Testing Available upon request

Note: Specifications can be tailored. Please contact us for the detailed technical data sheet of a specific grade.

Complete Your RFQ

0/ 2000

why choose us

Trusted Manufacturer

With our own production facilities, we ensure consistent quality, reliable supply, and full traceability.

Rigorous Quality Assurance

Each batch undergoes strict QC, accompanied by COA, MSDS, and full compliance with international standards.

Advanced R&D Expertise

Our in-house lab drives process innovation, new product development, and tailored synthesis solutions.